Rosalind MMCH – Maximum Matchings and RNA Secondary Structures Solution

For some time now I’ve been working on the little problems on Rosalind. Adn I’ve been stuck on one quite easy one, for ages.

And I’ve just solved it.  And the problem wasn’t to do with my code at all, it was to do with the differing versions of Python.

To solve this problem you use the inbuilt factorial function and the results from that differ under Python 2.7 and 3.

I am using 3 and obviously the people who are running Rosalind, are using 2.7.

So for instance, with this dataset:

>Rosalind_0258
ACCCUCAGCAAUUAUACAUUCGUGAACCUCCAAAUCUGAUGCGUGGCCGUUGGUACACUC
UCGCAAACGCUGUAGGACUCUCCAA

Python 2.7 gives  the answer: 124917299331128613009585280018022400000000 which is accepted.

And Python 3 gives the answer:124917299331128612574021702489190831226880 which looks to be more accurate to me, but is not accepted.

So I’m just posting this here in  case others who are stuck on this one can find the answer here.

The Town that Privatized Everything

Oh if only we could do this in Auckland:

The Town that Privatized Everything

https://d268xzw51cyeyg.cloudfront.net/wp-content/uploads/sites/725/2014/06/Sandy-Springs-Junk-Removal-Company.jpg

Sandy Springs, Georgia may look like any other town in America. It has parks, roads, and beautiful places to live. But there’s one thing that separates this town from every other town: Sandy Springs privatized almost everything.

In 2005, Sandy Springs outsourced almost all functions of the city government (with the exception of police and fire) to a single company, which runs the town. That company is in charge of running all the vital functions of government, from the running the parks, to paving the roads, and even 911 calls!

Rest of Article

Man, this would be my total wet dream.  Imagine being able to say to the likes of Len Brown, “Fuck off you’re useless” and hiring someone else.

First Home Buyer Plops Down $920,000 for House in Melbourne

How on earth does a first home buyer, described as a student, buy a house for $920,000???

http://news.domain.com.au/domain/real-estate-news/firsthome-buyer-pays-100000-above-reserve-in-glen-waverley-20150131-132swm.html

But it was a management student from mainland China who sealed the deal with a final bid, entering the race just minutes from the finish line.

So just another story about a mainland Chinese person winning an auction?

Well yes, but the really interesting thing was what he said, in the video, which (in Chinese) were words to the effect that he’d expected to pay over $1 million.

So, this kinda highlights how in fact, auctions can achieve lower prices than otherwise possible.  Something the likes of Neil Jenman et al keep saying.