Rosalind MMCH – Maximum Matchings and RNA Secondary Structures Solution

For some time now I’ve been working on the little problems on Rosalind. Adn I’ve been stuck on one quite easy one, for ages.

And I’ve just solved it.  And the problem wasn’t to do with my code at all, it was to do with the differing versions of Python.

To solve this problem you use the inbuilt factorial function and the results from that differ under Python 2.7 and 3.

I am using 3 and obviously the people who are running Rosalind, are using 2.7.

So for instance, with this dataset:

>Rosalind_0258
ACCCUCAGCAAUUAUACAUUCGUGAACCUCCAAAUCUGAUGCGUGGCCGUUGGUACACUC
UCGCAAACGCUGUAGGACUCUCCAA

Python 2.7 gives  the answer: 124917299331128613009585280018022400000000 which is accepted.

And Python 3 gives the answer:124917299331128612574021702489190831226880 which looks to be more accurate to me, but is not accepted.

So I’m just posting this here in  case others who are stuck on this one can find the answer here.

The Town that Privatized Everything

Oh if only we could do this in Auckland:

The Town that Privatized Everything

https://d268xzw51cyeyg.cloudfront.net/wp-content/uploads/sites/725/2014/06/Sandy-Springs-Junk-Removal-Company.jpg

Sandy Springs, Georgia may look like any other town in America. It has parks, roads, and beautiful places to live. But there’s one thing that separates this town from every other town: Sandy Springs privatized almost everything.

In 2005, Sandy Springs outsourced almost all functions of the city government (with the exception of police and fire) to a single company, which runs the town. That company is in charge of running all the vital functions of government, from the running the parks, to paving the roads, and even 911 calls!

Rest of Article

Man, this would be my total wet dream.  Imagine being able to say to the likes of Len Brown, “Fuck off you’re useless” and hiring someone else.

First Home Buyer Plops Down $920,000 for House in Melbourne

How on earth does a first home buyer, described as a student, buy a house for $920,000???

http://news.domain.com.au/domain/real-estate-news/firsthome-buyer-pays-100000-above-reserve-in-glen-waverley-20150131-132swm.html

But it was a management student from mainland China who sealed the deal with a final bid, entering the race just minutes from the finish line.

So just another story about a mainland Chinese person winning an auction?

Well yes, but the really interesting thing was what he said, in the video, which (in Chinese) were words to the effect that he’d expected to pay over $1 million.

So, this kinda highlights how in fact, auctions can achieve lower prices than otherwise possible.  Something the likes of Neil Jenman et al keep saying.

Big Government?

I’m no fan of big government but I do agree with this article:

Robert Reich: Big government isn’t the problem

The former secretary of labor on our newest spending bill — and why it’s everything that’s wrong with Washington

Topics: RobertReich.org, Big government, Dodd-Frank, Big Pharma, Capitalism, Business News, Politics News

Robert Reich: Big government isn't the problemRobert Reich
This originally appeared on Robert Reich’s blog.

Some believe the central political issue of our era is the size of the government. They’re wrong. The central issue is whom the government is for.

Consider the new spending bill Congress and the President agreed to a few weeks ago.

It’s not especially large by historic standards. Under the $1.1 trillion measure, government spending doesn’t rise as a percent of the total economy. In fact, if the economy grows as expected, government spending will actually shrink over the next year.

The problem with the legislation is who gets the goodies and who’s stuck with the tab.

For example, it repeals part of the Dodd-Frank Act designed to stop Wall Street from using other peoples’ money to support its gambling addiction, as the Street did before the near-meltdown of 2008.

Rat Trap Catches a Rat!

I posted a while back about how I’d bought an A24 Rat Trap from GoodNature.

It’s been a frustrating experience up till now because a) The cat has been bringing in rats and mice every other day and b) the trap didn’t seem to be catching anything.

The trouble with these traps is that you don’t know if they’re catching anything because the rat and mice carcasses can be removed by local cats.

So I bought an addition to the trap, a counter.  It’s an electronic counter that attaches to it and records every time it goes off.  I also bought some more detector cards.

These are the cards that you put around the place to see where rodents etc. are active.  They hold part of the

I had a couple of these cards hugely munched the other day and so assuming it was a possum, put the possum trap out for a few nights, but no luck catching anything in that.

And yesterday, I moved the rat trap out of the bush location I had it and put it where one of the detector cards had been attacked.  And then this morning, my 5 year old says he’s found something outside, which turned out to be a large dead rat, around 6 or 7m from the trap location.  And the counter said 2 (I set it off once myself to see if it was going) So after nearly 4 months using this trap, I’ve caught my first verified rat!

It’ll be interesting to see if I catch any more at this location or if I’ll have to move it.

Comments Disabled

A short while ago, the plugin I use to get rid of spam comments (around 250 per day) called Akismet, just stopped working.

And I’ve tried to get it going again, there’s lots on the web about it, but no single cure, and it’s all pretty techie, even too techie for me, so I’m disabling comments until I can sort it out.

If you need to contact me, look on the About page.

Celebrating Life's Little Achievements