Interesting Article on Patagonia

Patagonia’s Anti-Growth Strategy

Yet anti-consumerism is clearly helping to build the Patagonia brand. Indeed, the company is seeing double-digit annual growth.

The company’s anti-materialistic stance ramped up on Black Friday, 2011, with a memorable full-page advertisement in the Times that read, “Don’t Buy This Jacket.” The ad’s text broke down the environmental costs of the company’s top-selling R2 fleece sweater and asked consumers to think twice before buying it or any other product. The attention the ad received helped to bump Patagonia’s 2012 sales significantly.

 

Link

Rats

I’ve written a couple of posts on how I’m trying to catch/kill rats around our property in west Auckland.

I’ve tried a GoodNature trap – which has caught a total of 1 rat in over 6  months.  Got to say I’m dissappointed with it.

And a couple of weeks ago, we started hearing rats in the roof/ceiling cavity.

So we investigated, found lots of rat droppings up there.  Put the GoodNature trap up there along with 4 conventional traps.  We have caught 1 in a conventional trap.

Today we had a ceiling hatch put in a part of the roof/ceiling cavity we couldn’t get access into.  And I’ve set 2 conventional traps along with a bait station.

I hate to use the toxic stuff, but have no choice really, the rats are making a real mess up there and are really noisy too, waking us up each night as they scurry about, scratch etc.

Also put 2 bait stations outside the house.  Will be interesting to see if they get rat attention.

The cat has been catching one about every 10 days or so as well.  The other day he caught and killed a really big one.

So there’s obviously heaps of them about.  Will be good to get rid of them!

Auckland Ratepayer’s Alliance

This organisation: http://www.ratepayers.nz/ has started today. They are called the Auckland Ratepayer’s Alliance. Their aims are:

What are the aims of the Auckland Ratepayers’ Alliance?
The aims of the Auckland Ratepayers’ Alliance are to:

  • reduce wasteful Council spending;
  • increase transparency and accountability of those funded by ratepayers;
  • increase institutional checks on the Council;
  • enable Aucklanders to easily scrutinise Council spending;
  • lower the rates burden; and
  • promote evidence-based public policy.

I might join, it’s free.

Haha Someone Actually Dumps Shit on Otago Regional Council

Well I had to laugh at this:

Upset farmers dump excrement at regional council

By Timothy Brown

Contractors prepare to clean up excrement dumped outside the Otago Regional Council's Dunedin office by a disgruntled North Otago farming couple. Photo / Peter McIntosh
Contractors prepare to clean up excrement dumped outside the Otago Regional Council’s Dunedin office by a disgruntled North Otago farming couple. Photo / Peter McIntosh

An ongoing dispute with a North Otago farmer who says he is at his wit’s end has landed the Otago Regional Council in the poo – literally.

Five Forks farmer Robert Borst says the ORC’s water plan change 6A has ”destroyed us as a family” and provided four years of ”sheer frustration and exhaustion” for him and his wife, Sylvia.

When told last night the ORC still hoped to resolve the dispute, he replied: ”Bull… – absolute bull…”.

Link

Man I feel for these people.  Dealing with councils is one of life’s most frustrating things.

 

Rosalind MMCH – Maximum Matchings and RNA Secondary Structures Solution

For some time now I’ve been working on the little problems on Rosalind. Adn I’ve been stuck on one quite easy one, for ages.

And I’ve just solved it.  And the problem wasn’t to do with my code at all, it was to do with the differing versions of Python.

To solve this problem you use the inbuilt factorial function and the results from that differ under Python 2.7 and 3.

I am using 3 and obviously the people who are running Rosalind, are using 2.7.

So for instance, with this dataset:

>Rosalind_0258
ACCCUCAGCAAUUAUACAUUCGUGAACCUCCAAAUCUGAUGCGUGGCCGUUGGUACACUC
UCGCAAACGCUGUAGGACUCUCCAA

Python 2.7 gives  the answer: 124917299331128613009585280018022400000000 which is accepted.

And Python 3 gives the answer:124917299331128612574021702489190831226880 which looks to be more accurate to me, but is not accepted.

So I’m just posting this here in  case others who are stuck on this one can find the answer here.

The Town that Privatized Everything

Oh if only we could do this in Auckland:

The Town that Privatized Everything

https://d268xzw51cyeyg.cloudfront.net/wp-content/uploads/sites/725/2014/06/Sandy-Springs-Junk-Removal-Company.jpg

Sandy Springs, Georgia may look like any other town in America. It has parks, roads, and beautiful places to live. But there’s one thing that separates this town from every other town: Sandy Springs privatized almost everything.

In 2005, Sandy Springs outsourced almost all functions of the city government (with the exception of police and fire) to a single company, which runs the town. That company is in charge of running all the vital functions of government, from the running the parks, to paving the roads, and even 911 calls!

Rest of Article

Man, this would be my total wet dream.  Imagine being able to say to the likes of Len Brown, “Fuck off you’re useless” and hiring someone else.

First Home Buyer Plops Down $920,000 for House in Melbourne

How on earth does a first home buyer, described as a student, buy a house for $920,000???

http://news.domain.com.au/domain/real-estate-news/firsthome-buyer-pays-100000-above-reserve-in-glen-waverley-20150131-132swm.html

But it was a management student from mainland China who sealed the deal with a final bid, entering the race just minutes from the finish line.

So just another story about a mainland Chinese person winning an auction?

Well yes, but the really interesting thing was what he said, in the video, which (in Chinese) were words to the effect that he’d expected to pay over $1 million.

So, this kinda highlights how in fact, auctions can achieve lower prices than otherwise possible.  Something the likes of Neil Jenman et al keep saying.

Celebrating Life's Little Achievements